This quiz works best with JavaScript enabled. Home > Biotechnology > Genetic Engineering > Genetic Engineering – Quiz 77 🏠 Homepage 📘 Download PDF Books 📕 Premium PDF Books Genetic Engineering Quiz 77 (20 MCQs) Quiz Instructions Select an option to see the correct answer instantly. 1. A new variety of rice called golden rice has been genetically modified to have vitamin A. people in starving countries can eat this rice and receive vitamin A. Without this rice people go blind from vitamin A deficiency. What word(s) below best describes this rice? A) Electrophoresis. B) DNA fingerprint. C) Genetically modified organism. D) Clone. Show Answer Correct Answer: C) Genetically modified organism. 2. MRNA is converted to cDNA by ..... A) Ligase enzyme. B) Reverse Transcriptase enzyme. C) Restriction Endonuclease enzyme. D) RNA polymerase enzyme. Show Answer Correct Answer: B) Reverse Transcriptase enzyme. 3. An organism containing recombinant DNA from different species A) Transgenic. B) Restriction enzyme. C) Plasmid. D) A norma, non-glowing mouse. Show Answer Correct Answer: A) Transgenic. 4. Leaving a space between the two primers, which cause A) Insertion. B) Deletions. C) Framshift. D) None of above. Show Answer Correct Answer: B) Deletions. 5. What is the genotype of parent 2? A) SS. B) Ss. C) Ss. D) You cannot tell from this information. Show Answer Correct Answer: B) Ss. 6. What methods can be used to verify cloned DNA in molecular cloning? A) Western blotting, Southern blotting, and Northern blottingGel electrophoresis, Centrifugation, and. B) Gel electrophoresis, Centrifugation, and Spectrophotometry. C) ELISA, Flow cytometry, and Immunohistochemistry. D) Restriction enzyme digestion, DNA sequencing, and PCR. Show Answer Correct Answer: D) Restriction enzyme digestion, DNA sequencing, and PCR. 7. A visible mass of bacteria all originating from a single mother cell, therefore constitutes a clone of bacteria all genetically alike. A) E. coli. B) Culture. C) Media. D) Colony. Show Answer Correct Answer: D) Colony. 8. How many fragments would be produced in the following DNA when is treated with HindIII and Alul?ATCTAGCTGCGCAAGCTTGCTAGCTGCAGCTCGAGCTTAGATCGACGCGTTCGAACGATCGACGTCGAGCTCGA A) 3. B) 4. C) 5. D) 6. Show Answer Correct Answer: D) 6. 9. Taking a human insulin gene and putting it into a bacterial plasmid is a type of A) Genetic engineering. B) Selective breeding. Show Answer Correct Answer: A) Genetic engineering. 10. What is the function of DNA Polymerase? A) Attach primers to target sequence. B) Separate the DNA. C) Attach nucleotides to the target sequence. D) Separate the fragments according to size. Show Answer Correct Answer: C) Attach nucleotides to the target sequence. 11. Which enzyme is responsible for synthesising a single-stranded DNA from an mRNA? A) Restriction endonuclease. B) DNA polymerase. C) DNA ligase. D) Reverse transcriptase. Show Answer Correct Answer: D) Reverse transcriptase. 12. The substance represented by the scissors shown cutting the DNA is A) An enzyme. B) A starch molecule. C) A carbohydrate. D) A fat molecule. Show Answer Correct Answer: A) An enzyme. 13. DNA from one organism contains information that can specify traits in another organism A) True. B) False. Show Answer Correct Answer: A) True. 14. An example of selective breeding is A) A dog breeder mating 2 dogs to make more dogs. B) A farmer grows bees to pollinate the plants on his farm. C) A person pollinates 2 white rose plants to only create white roses. D) None of above. Show Answer Correct Answer: C) A person pollinates 2 white rose plants to only create white roses. 15. DNA molecule segment is:TTACGCAAG The mutated DNA segment is TTCGCAAG. This is an example of ..... mutation. A) Substitution. B) Deletion. C) Insertion. D) Inversion. Show Answer Correct Answer: B) Deletion. 16. What are some examples of genetically modified crops? A) Potatoes, carrots, lettuce. B) Apples, oranges, bananas. C) Wheat, rice, barley. D) Soybeans, corn, cotton, and canola. Show Answer Correct Answer: D) Soybeans, corn, cotton, and canola. 17. Where in the diagram are the smallest DNA fragments? A) The top. B) The middle. C) The bottom. D) None of above. Show Answer Correct Answer: C) The bottom. 18. Describe the role of DNA in genetic engineering. A) DNA serves as the blueprint for genetic engineering, providing the instructions for the desired changes to be made in an organism's genetic makeup. B) DNA only provides physical characteristics, not genetic changes. C) Genetic engineering does not require the use of DNA. D) DNA is not involved in genetic engineering. Show Answer Correct Answer: A) DNA serves as the blueprint for genetic engineering, providing the instructions for the desired changes to be made in an organism's genetic makeup. 19. Plasmids are used to A) Insert foreign DNA. B) Clone an animal. C) Cut DNA. D) None of above. Show Answer Correct Answer: A) Insert foreign DNA. 20. What is the process of changing a gene to treat a medical disease or disorder? A) Gene Therapy. B) Gene Splicing. C) DNA Fingerprinting. D) Gene Cloning. Show Answer Correct Answer: A) Gene Therapy. ← PreviousNext →Related QuizzesBiotechnology QuizzesGenetic Engineering Quiz 1Genetic Engineering Quiz 2Genetic Engineering Quiz 3Genetic Engineering Quiz 4Genetic Engineering Quiz 5Genetic Engineering Quiz 6Genetic Engineering Quiz 7Genetic Engineering Quiz 8Genetic Engineering Quiz 9 🏠 Back to Homepage 📘 Download PDF Books 📕 Premium PDF Books