Genetic Engineering Quiz 77 (20 MCQs)

Quiz Instructions

Select an option to see the correct answer instantly.

1. A new variety of rice called golden rice has been genetically modified to have vitamin A. people in starving countries can eat this rice and receive vitamin A. Without this rice people go blind from vitamin A deficiency. What word(s) below best describes this rice?
2. MRNA is converted to cDNA by .....
3. An organism containing recombinant DNA from different species
4. Leaving a space between the two primers, which cause
5. What is the genotype of parent 2?
6. What methods can be used to verify cloned DNA in molecular cloning?
7. A visible mass of bacteria all originating from a single mother cell, therefore constitutes a clone of bacteria all genetically alike.
8. How many fragments would be produced in the following DNA when is treated with HindIII and Alul?ATCTAGCTGCGCAAGCTTGCTAGCTGCAGCTCGAGCTTAGATCGACGCGTTCGAACGATCGACGTCGAGCTCGA
9. Taking a human insulin gene and putting it into a bacterial plasmid is a type of
10. What is the function of DNA Polymerase?
11. Which enzyme is responsible for synthesising a single-stranded DNA from an mRNA?
12. The substance represented by the scissors shown cutting the DNA is
13. DNA from one organism contains information that can specify traits in another organism
14. An example of selective breeding is
15. DNA molecule segment is:TTACGCAAG The mutated DNA segment is TTCGCAAG. This is an example of ..... mutation.
16. What are some examples of genetically modified crops?
17. Where in the diagram are the smallest DNA fragments?
18. Describe the role of DNA in genetic engineering.
19. Plasmids are used to
20. What is the process of changing a gene to treat a medical disease or disorder?