This quiz works best with JavaScript enabled. Home > Agriculture > Biotechnology > Genetic Engineering > Genetic Engineering – Quiz 51 🏠 Homepage 📘 Download PDF Books 📕 Premium PDF Books Genetic Engineering Quiz 51 (30 MCQs) Quiz Instructions Select an option to see the correct answer instantly. 1. What is the genotype of parent 2? A) SS. B) Ss. C) Ss. D) You cannot tell from this information. Show Answer Correct Answer: B) Ss. 2. What methods can be used to verify cloned DNA in molecular cloning? A) Western blotting, Southern blotting, and Northern blottingGel electrophoresis, Centrifugation, and. B) Gel electrophoresis, Centrifugation, and Spectrophotometry. C) ELISA, Flow cytometry, and Immunohistochemistry. D) Restriction enzyme digestion, DNA sequencing, and PCR. Show Answer Correct Answer: D) Restriction enzyme digestion, DNA sequencing, and PCR. 3. A visible mass of bacteria all originating from a single mother cell, therefore constitutes a clone of bacteria all genetically alike. A) Media. B) E. coli. C) Culture. D) Colony. Show Answer Correct Answer: D) Colony. 4. How many fragments would be produced in the following DNA when is treated with HindIII and Alul?ATCTAGCTGCGCAAGCTTGCTAGCTGCAGCTCGAGCTTAGATCGACGCGTTCGAACGATCGACGTCGAGCTCGA A) 6. B) 3. C) 5. D) 4. Show Answer Correct Answer: A) 6. 5. Taking a human insulin gene and putting it into a bacterial plasmid is a type of A) Genetic engineering. B) Selective breeding. Show Answer Correct Answer: A) Genetic engineering. 6. What is the function of DNA Polymerase? A) Separate the fragments according to size. B) Attach nucleotides to the target sequence. C) Attach primers to target sequence. D) Separate the DNA. Show Answer Correct Answer: B) Attach nucleotides to the target sequence. 7. Which enzyme is responsible for synthesising a single-stranded DNA from an mRNA? A) DNA polymerase. B) Restriction endonuclease. C) Reverse transcriptase. D) DNA ligase. Show Answer Correct Answer: C) Reverse transcriptase. 8. The substance represented by the scissors shown cutting the DNA is A) A fat molecule. B) A starch molecule. C) An enzyme. D) A carbohydrate. Show Answer Correct Answer: C) An enzyme. 9. DNA from one organism contains information that can specify traits in another organism A) False. B) True. Show Answer Correct Answer: B) True. 10. An example of selective breeding is A) A dog breeder mating 2 dogs to make more dogs. B) A farmer grows bees to pollinate the plants on his farm. C) A person pollinates 2 white rose plants to only create white roses. D) None of above. Show Answer Correct Answer: C) A person pollinates 2 white rose plants to only create white roses. 11. DNA molecule segment is:TTACGCAAG The mutated DNA segment is TTCGCAAG. This is an example of ..... mutation. A) Insertion. B) Substitution. C) Inversion. D) Deletion. Show Answer Correct Answer: D) Deletion. 12. What are some examples of genetically modified crops? A) Potatoes, carrots, lettuce. B) Apples, oranges, bananas. C) Wheat, rice, barley. D) Soybeans, corn, cotton, and canola. Show Answer Correct Answer: D) Soybeans, corn, cotton, and canola. 13. Where in the diagram are the smallest DNA fragments? A) The top. B) The middle. C) The bottom. D) None of above. Show Answer Correct Answer: C) The bottom. 14. Describe the role of DNA in genetic engineering. A) DNA is not involved in genetic engineering. B) Genetic engineering does not require the use of DNA. C) DNA serves as the blueprint for genetic engineering, providing the instructions for the desired changes to be made in an organism's genetic makeup. D) DNA only provides physical characteristics, not genetic changes. Show Answer Correct Answer: C) DNA serves as the blueprint for genetic engineering, providing the instructions for the desired changes to be made in an organism's genetic makeup. 15. Plasmids are used to A) Insert foreign DNA. B) Clone an animal. C) Cut DNA. D) None of above. Show Answer Correct Answer: A) Insert foreign DNA. 16. What is the process of changing a gene to treat a medical disease or disorder? A) Gene Splicing. B) Gene Therapy. C) DNA Fingerprinting. D) Gene Cloning. Show Answer Correct Answer: B) Gene Therapy. 17. Trait shows only if both parents pass it on A) Recessive. B) Dominant. C) Codominance. D) None of above. Show Answer Correct Answer: A) Recessive. 18. Which of the following best describes a "vector?" A) A type of protein in your body associated with viruses. B) A microscopic "agent" that causes an infection. C) An organism that carries something. D) A type of cell in your body that carries viruses. Show Answer Correct Answer: C) An organism that carries something. 19. What is the process called where specific traits are chosen to be passed on to the next generation? A) Selective Breeding. B) Gene Therapy. C) Cloning. D) Hybridization. Show Answer Correct Answer: A) Selective Breeding. 20. You find confidential information while using your mom's work computer. You close it immediately and do not share any of the information with anyone. This is ..... A) Unethical behavior. B) Ethical behavior. Show Answer Correct Answer: B) Ethical behavior. 21. Which of the following best describes the function of ligase? A) Cutting DNA. B) Repairing DNA. Show Answer Correct Answer: B) Repairing DNA. 22. Genetic engineering help in one of the following. A) To produce transgenic organism. B) To produce GMO. C) To change the genotype. D) All of the above. Show Answer Correct Answer: D) All of the above. 23. What is the purpose of the Extension step of PCR? A) To create the primers. B) To extend the time it takes to produce DNA. C) To allow polymerase to create the complementary strands of DNA. D) To allow substrates to copy DNA sequences. Show Answer Correct Answer: C) To allow polymerase to create the complementary strands of DNA. 24. What is a potential consequence of gene therapy becoming an option for expecting parents? A) It will be extremely affordable for all expecting parents. B) It will be limited to certain countries that are more open to HGE technology. C) It will result in the destruction of the human race. D) It will only be available for unborn babies. Show Answer Correct Answer: B) It will be limited to certain countries that are more open to HGE technology. 25. One of the biggest breakthroughs in recombinant DNA and genetic engineering in humans is ..... A) Ability to regrow a damaged liver for alcoholics with Cirrhosis. B) New skin cells for skin cancer patients. C) Using bacteria to produce human insulin. D) A vaccine that can be put into a bannana. Show Answer Correct Answer: C) Using bacteria to produce human insulin. 26. Paper chromatography A) Separates molecules by size. B) Uses electricity to separate molecules. C) Is a structural observation. D) All of these. Show Answer Correct Answer: A) Separates molecules by size. 27. What is the technique called that scientists use to produce large amounts of DNA in a remarkably small amount of time from a small sample? A) Polymerase Chain Reaction. B) Polyploidy Chain Reaction. C) Polymorphism Chain Reaction. D) None of above. Show Answer Correct Answer: A) Polymerase Chain Reaction. 28. In a pedigree chart, how are relations illustrated A) Circles. B) Shading. C) Lines. D) Squares. Show Answer Correct Answer: C) Lines. 29. What is the purpose of obtaining recombinant DNA? A) To create new species. B) To improve the food industry. C) To combat genetic diseases. D) To obtain specific proteins. Show Answer Correct Answer: D) To obtain specific proteins. 30. What type of protein cuts DNA at specific locations? A) Helicase. B) Restriction enzymes. C) DNA ligase. D) DNA polymerase. Show Answer Correct Answer: B) Restriction enzymes. ← PreviousNext →Related QuizzesBiotechnology QuizzesAgriculture QuizzesGenetic Engineering Quiz 1Genetic Engineering Quiz 2Genetic Engineering Quiz 3Genetic Engineering Quiz 4Genetic Engineering Quiz 5Genetic Engineering Quiz 6Genetic Engineering Quiz 7Genetic Engineering Quiz 8 🏠 Back to Homepage 📘 Download PDF Books 📕 Premium PDF Books