Genetic Engineering Quiz 51 (30 MCQs)

Quiz Instructions

Select an option to see the correct answer instantly.

1. What is the genotype of parent 2?
2. What methods can be used to verify cloned DNA in molecular cloning?
3. A visible mass of bacteria all originating from a single mother cell, therefore constitutes a clone of bacteria all genetically alike.
4. How many fragments would be produced in the following DNA when is treated with HindIII and Alul?ATCTAGCTGCGCAAGCTTGCTAGCTGCAGCTCGAGCTTAGATCGACGCGTTCGAACGATCGACGTCGAGCTCGA
5. Taking a human insulin gene and putting it into a bacterial plasmid is a type of
6. What is the function of DNA Polymerase?
7. Which enzyme is responsible for synthesising a single-stranded DNA from an mRNA?
8. The substance represented by the scissors shown cutting the DNA is
9. DNA from one organism contains information that can specify traits in another organism
10. An example of selective breeding is
11. DNA molecule segment is:TTACGCAAG The mutated DNA segment is TTCGCAAG. This is an example of ..... mutation.
12. What are some examples of genetically modified crops?
13. Where in the diagram are the smallest DNA fragments?
14. Describe the role of DNA in genetic engineering.
15. Plasmids are used to
16. What is the process of changing a gene to treat a medical disease or disorder?
17. Trait shows only if both parents pass it on
18. Which of the following best describes a "vector?"
19. What is the process called where specific traits are chosen to be passed on to the next generation?
20. You find confidential information while using your mom's work computer. You close it immediately and do not share any of the information with anyone. This is .....
21. Which of the following best describes the function of ligase?
22. Genetic engineering help in one of the following.
23. What is the purpose of the Extension step of PCR?
24. What is a potential consequence of gene therapy becoming an option for expecting parents?
25. One of the biggest breakthroughs in recombinant DNA and genetic engineering in humans is .....
26. Paper chromatography
27. What is the technique called that scientists use to produce large amounts of DNA in a remarkably small amount of time from a small sample?
28. In a pedigree chart, how are relations illustrated
29. What is the purpose of obtaining recombinant DNA?
30. What type of protein cuts DNA at specific locations?